Cell lines
The cell lines used are described in Table 1.

Cell culture and cell synchronization
The cells were grown at 37°C in the presence of 5% CO2 atmosphere and maintained in DMEM (Life Technologies Inc.) supplemented with either 10% newborn calf serum (NBCS; Gibco) (NIH3T3 and its derivatives) or in 10% fetal calf serum (FCS; Life Technologies Inc.) (CCL-137, WI-38, T-24, A-375, Malme-3M, G361, WM239, SK-MEL-28, p53-/- and +/+ MEFs). SW480 cells were cultured in RPMI 1640 medium in the presence of 10% FCS, and RPMI-7951 and SK-MEL-2 cells in MEM supplemented with 10% FSC and non-essential amino acids. Primary MEFs were used between passages 3 to 8, and human skin derived melanocytes below passage 10.
NIH3T3 cells were synchronized to G0/G1 by contact inhibition and serum starvation for 8 h in the presence of 0.2% NBCS and released to cycle by replating cells in culture medium containing 10% NBCS. Synchronization to G1/S was performed by initial serum starvation as above, followed by addition of fresh medium in the presence of 0.25 mM hydroxyurea (HU) (Sigma) and incubation for 16 h. After removal of HU-block the cells entered synchoronously into S. HU alone had no effect on p53 levels nor p53 DNA-binding activity.
UV treatment of cells
For UV treatment, medium was removed and the cells were exposed to UVC (254 nm) at a dose of 10 - 200 J/m2 with UV-Stratalinker 1800 (I, II) or 2400 (III, IV) (Stratagene). Fresh medium was added, also to unradiated control cells, and cells were incubated for the indicated periods of time before analysis.
Immunoblotting
For semiquantitative analysis of protein by immunoblotting the cells were washed with cold 25 mM Tris-HCl (pH 8.0), containing 150 mM NaCl (Tris buffered saline, TBS), and lysed with 25 mM Tris-HCl (pH 8.0), containing 120 mM NaCl, 0.5% Nonidet P-40 (NP-40), 4 mM NaF, 100 µM Na3VO4, 100 KIU/ml aprotinin, 1 mM PMSF, and 10 µg/ml leupeptin at 4°C for 25 min. Cell lysates were clarified by microcentrifugation, and protein concentrations were determined by Bradford analysis. Lysates (200 - 500 µg) were analysed by 7.5% or 12.5% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions followed by transfer of proteins to Immobilon-PTM membranes (Millipore). The membranes were probed either with monoclonal antibody PMG3-245 (PharMingen) against pRB, monoclonal DO-1 (Santa Cruz Biotechnology) or monoclonal PAb240 (PharMingen) against human and mouse p53, respectively, monoclonal 6B6 (PharMingen) against human p21, or either polyclonal M-19 (Santa Cruz Biotechnology) or polyclonal 13436E (PharMingen) against mouse p21. PAb240 recognizes only mutant p53 under non-denaturing conditions, but both mutant and wild-type p53 under denaturing conditions. DO-1 antibody recognizes both forms of human p53. The antibodies were detected with peroxidase-conjugated secondary antibodies followed by enhanced chemiluminescence (ECL; Amersham). When indicated, densitometric scans of the immunoblots were analysed using NIH Image 1.47 program. Even loading of samples to polyacrylamide gel was verified by staining parts of the gel with Coomassie Brilliant Blue and of membranes by Ponceau S.
Immunofluorescence and 5-BrdUrd incorporation
Cells were grown on glass coverslips, fixed with methanol (MeOH) and acetone (1:1) for 5 min and stained for 1 h with primary antibody PMG3-245 to detect pRB, PAb 246 (PharMingen) or DO-1 to detect mouse and human p53, respectively. Subsequently, the coverslips were incubated with rhodamine-conjugated rabbit anti-mouse antibody (Dako), and nuclei were counterstained with 2 µg/ml Hoechst 33258. The stainings were visualised with 100 x magnification under UV illumination with an Olympus BH-2 microscope.
DNA replication was determined by 5-bromo-2´-deoxyuridine (5-BrdUrd) incorporation. Cells grown on coverslips were incubated with 50 µM 5-BrdU (Sigma) for 1 or 2 h and fixed with ice cold MeOH for 5 min. After permeabilisation of cell membranes with 1.5 N HCl for 20 min, cells were stained with monoclonal 5-BrdUrd antibody (Amersham) and rhodamine-conjugated rabbit anti-mouse antibody (Dako), both for 1 h. Nuclei were stained with 2 µg/ml Hoechst 33258 for 2 min and after visualisation with a microscope, the proportion of 5-BrdUrd positive nuclei of all Hoechst dye-stained nuclei was determined.
Northern (RNA) blotting
Poly(A)+ mRNA was isolated from cells by oligo(dT) cellulose, separated in 1% agarose gels containing formaldehyde and transferred to Hybond-N membrane (Amersham) in 20X SSC (3 M NaCl, 0.3 M sodium citrate, pH 7.0). mRNA was detected by probing with p21 (El-Deiry et al., 1993), GADD45 (Fornace et al., 1988), or mdm2 cDNA inserts (kindly provided by Dr. B. Vogelstein, Dr. A. J. Fornace Jr., and Dr. A. Levine, respectively) labeled with [32P]dCTP by random priming. Quantitations of the autoradiograms were carried out with Fujifilm BAS-1500 image analyser and the MacBAS 2.1 program. Fold inductions were calculated by normalizing the mRNA levels to the level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and comparing the signals of the UV-treated and control cells.
Flow cytometry
For analysis of cell cycle phase distribution by flow cytometry the cells were trypsinized, centrifuged for 5 min at 1500 rpm, washed with phosphate-buffered saline (PBS), fixed with ice cold MeOH and stored at -20°C. Subsequently, thawed cells were centrifuged, washed with PBS, resuspended in 0.5 ml of PBS containing 50 µg/ml RNase A (Sigma), and incubated for 30 min at 37°C. DNA was stained with 50 µg/ml propidium iodide (Sigma) overnight, and flow cytometry analysis was performed by FACScan (Becton-Dickinson). The data of cell cycle distribution was analyzed using the CellFIT Cell Cycle Analysis program.
Assays for apoptosis
UV-treatment induced morphological changes of nuclei, apoptotic nuclear condensation and fragmentation, were estimated from cells fixed on glass coverslips and stained with DNA dye Hoechst 33258 (Sigma) at a concentration of 2 µg/ml for 2 min, and the extent of apoptotic changes was visualised with an Olympus BH-2 microscope under UV illumination. In addition, A0-cell population, representing apoptotic cells with less than 2N DNA content, was determined by flow cytometry analysis.
Electrophoretic gel mobility shift assay
Nuclear extracts were prepared as described previously (Andrews et al., 1991). Oligonucleotides representing the consensus p53 binding sites either in the p21CIP-1/WAF-1 gene promoter (El-Deiry et al., 1992), 5´-AATTCTCGAGGAACA-TGTCCCAACATGTTGCTCGG-3´, or mutated binding site 5´-GAATTCTCGAGG-AAAATTTCCCAAAATTTTGCTCGAG-3´ were synthesized, annealed into double-stranded form and labeled with 32P using T4 polynucleotide kinase (New England Biolabs). Oligonucleotide probes for wild-type (ATTCGGTCCCGCCTCCTTGAG-AGC) or mutant (ATTCGGTCCCGGAATCCTTGAGAGC) Sp1-binding sites were prepared similarly. Binding reactions contained 10 µg of nuclear extract, 10 µl of 2x binding buffer [40 mM Hepes-KOH pH 7.9, 50 mM KCl, 0.2 mM EDTA, 20% glycerol, 4 mM MgCl, 1 mM dithiothreitol, 0.05% NP-40, 4 mM spermidine (Sigma), and 100 ng poly(deoxyinosinic-deoxycytidylic acid) (Pharmacia)], and, when indicated, 500 ng of specific antibody in a final volume of 20 µl. Binding reactions were incubated at room temperature for 20 min, 0.2 ng of labeled oligonucleotide probe was added and the incubation was continued for an additional 20 min at room temperature. Reaction products were separated on a 4% nondenaturing polyacrylamide gel with 0.25X Tris-borate-EDTA buffer supplemented with 5% glycerol at 4°C. After drying, the gel was exposed to X-ray film.
Cell transfections and chloramphenicol acetyltransferase (CAT) assay
NIH 3T3 cells were co-transfected with PG13-CAT or MG15-CAT constructs (kindly provided by Dr. B. Vogelstein) (Kern et al., 1992) and with pcDneo neomycin resistance gene (Chen et al., 1987) by the calcium phosphate precipitation method and grown in the presence of 0.6 mg/ml G418 (Gibco) for two weeks. Stable cell colonies from both transfections were trypsinized and pooled. For measurement of CAT-activity the cells were pelleted, lysed and equal concentrations of protein were incubated with acetyl coenzyme A (Pharmacia) and 0.4 mCi of [14C]chloramphenicol (Amersham). The acetylated chloramphenicol was separated by thin-layer chromatography (Gorman et al., 1982), and signals of the acetylated forms of [14C]chloramphenicol were quantitated with a Fujifilm BAS-1500 image analyzer.
p53 sequencing
Reverse transcription-polymerase chain reaction (RT-PCR) was used to generate cDNA, and all DNAs representing exons 1-11 of p53 gene were sequenced. For RT-PCR, two sets of primers generating a terminal, 774-bp fragment (forward primer, CTGCTGGGCTCCGGGGACACTTTG; reverse primer AGGCGGCTCATAGGG-CACCACCAC) and a COOH-terminal 890 bp fragment (forward primer, TACTCC-CCTGCCCTCAACAAGATG; reverse primer TTCAAAGACCCAAAACCCAAA-ATG) were used. cDNA was sequenced from both strands using automated DNA sequencing, and the sequences were compared against p53 cDNAs in the databases.
p21 promoter analyses
NIH3T3 and p53-/- MEFs were transiently transfected by the calcium phosphate precipitation method with p21 promoter deletion constructs, which were a kind gift from Dr. X.-F. Wang (Datto et al., 1995). Additionally, p21 promoter constructs containing two or three mutated Sp1-binding sites (mut 2+4, TATCTAGAAC TGAGGCGGGC ATCTAGACAT [-83 - -54]; and mut 2+3+4, TATCTAGAAC CTCTAGAAAT ATCTAGACAT [-83- -54]) were generated using one mutated Sp1-binding site containing construct (mut 2, mut 3, or mut 4) as the template in two successive PCR reactions with appropriate primers. The identities of PCR products were verified by sequencing and then cloned into 93-S vector (Kivinen et al., 1999). The cells were treated with UV radiation 24 h after transfection and after additional 20 h incubation luciferase activity was determined by Dual-Luciferase reporter assay system (Promega). As an internal control of transfection efficiencies pRL-TK expression plasmid coding for Renilla luciferase was included in each transfection.